ITS fungal amplicon analysis
Upload ITS1 or ITS2 amplicon FASTQ files and get fungal ASVs, UNITE v9.0 taxonomy, composition and diversity in a publication-ready report. Same pipeline and pricing as 16S, processed and stored in Canada.
What is ITS amplicon analysis?
ITS analysis profiles the fungi in a sample by sequencing the internal transcribed spacer (ITS), the region between the ribosomal RNA genes that is the formal DNA barcode for fungi. Like 16S analysis for bacteria, it turns amplicon reads into sequence variants, names them against a reference database and measures community diversity.
Supported ITS primers
| Region | Forward primer | Reverse primer | Insert length | Reads needed to merge |
|---|---|---|---|---|
| ITS1 | ITS1FCTTGGTCATTTAGAGGAAGTAA | ITS2GCTGCGTTCTTCATCGATGC | Variable | No fixed truncation |
| ITS2 | ITS3GCATCGATGAAGAACGCAGC | ITS4TCCTCCGCTTATTGATATGC | Variable | No fixed truncation |
Used different ITS primers, such as gITS7 or fITS7? Choose Custom primers on upload and paste the exact sequences.
How the ITS pipeline works
- Primer removal with Cutadapt; reads without the expected primer are discarded.
- Denoising with DADA2 into ITS amplicon sequence variants, without fixed-length truncation.
- Taxonomy against UNITE v9.0, from kingdom to species where resolvable.
- Diversity: alpha diversity and rarefaction for each sample, with beta diversity, PERMANOVA and ANCOM-BC2 across groups in projects.
- Report: interactive composition charts, AI-assisted interpretation, PDF and data tables.
Phylogeny-based metrics (Faith's PD) and PICRUSt2 functional prediction are designed for 16S data and are not meaningful for ITS.
Data handling
Sequencing data is processed and stored on servers in Canada. See data security for details.
ITS analysis pricing
ITS uses the same per-sample tiers as 16S, in Canadian dollars.
Amplicon Basic
- Primer trimming (Cutadapt)
- DADA2 denoising and ASV table
- Taxonomy against SILVA v138.2 (16S) or UNITE v9.0 (ITS)
- Phylum, genus and species composition
- AI-assisted interpretation
- PDF and interactive web report
- Paired-end and single-end reads
Amplicon Complete
- Everything in Amplicon Basic
- Species-level assignment where the region resolves it
- Phylogenetic tree (MAFFT + FastTree)
- Alpha diversity: Shannon, Simpson, Chao1, Faith's PD
- Rarefaction curves
- Functional prediction (PICRUSt2)
- Multi-sample projects: beta diversity, PERMANOVA, ANCOM-BC2
- Research data package (ZIP)
ITS fungal analysis FAQ
What reference database is used for ITS fungal analysis?
ITS amplicon sequence variants are classified against UNITE v9.0, the curated reference database for fungal ITS sequences, using the DADA2 naive Bayes classifier.
Why are ITS reads not truncated to a fixed length?
The ITS region varies in length between fungal species, from under 100 bp to several hundred. Truncating every read to one length would discard or corrupt the long and short variants, so the ITS workflow removes primers without fixed-length truncation.
Should I sequence ITS1 or ITS2?
Both are widely used. ITS1 with ITS1F/ITS2 is common in soil and plant studies; ITS2 with ITS3/ITS4 is often preferred for its more even amplification across fungal groups. Use the same region for every sample you want to compare.
Can I analyze 16S and ITS from the same samples?
Yes. Upload the 16S and ITS reads as separate analyses with their own primer presets. Each is classified against its own database: SILVA for bacteria and UNITE for fungi.
Analyze your ITS amplicon data
Your first 3 analyses are free, with no credit card. Upload FASTQ files and get a publication-ready report, processed and stored in Canada.