16S rRNA & ITS microbiome analysis, from FASTQ to report
Upload your 16S or ITS amplicon FASTQ files and get ASVs, taxonomy, diversity statistics and publication-ready figures in about an hour. No coding and no HPC cluster.
The analysis step after your 16S sequencing run
BioAnalysis.ca turns raw amplicon reads from any sequencing core or provider into a complete microbiome profile. It removes primers, denoises reads into amplicon sequence variants (ASVs) with DADA2, assigns taxonomy against SILVA or UNITE, and computes diversity, phylogeny and predicted function.
For multi-sample studies it fits one shared error model, compares groups from your metadata with PERMANOVA and ANCOM-BC2, and produces figures ready for a manuscript.
- ASV table and taxonomy from phylum to species where the region resolves it
- Alpha diversity: Shannon, Simpson, Chao1, observed ASVs, Faith's PD
- Beta diversity (Bray-Curtis, Jaccard), PCoA and PERMANOVA across groups
- Differential abundance with ANCOM-BC2
- Predicted metabolic pathways with PICRUSt2
- Interactive report, PDF, figures and a research data package
From FASTQ to microbiome report in three steps
No command line, no software to install and no queue on a shared cluster.
Upload FASTQ
Drag in .fastq or .fastq.gz files. Pick your 16S or ITS primer preset, or enter custom primers.
Automated pipeline
Primers are checked, reads are denoised with DADA2 and classified against SILVA v138.2 or UNITE v9.0.
Explore and download
Interactive charts, diversity statistics, PDF and full data tables, plus an AI-assisted interpretation of multi-sample studies.
The 16S rRNA analysis pipeline
Peer-reviewed, widely cited tools, run in a fixed and documented order. Every report records the versions used.
Supported 16S and ITS regions
Presets for the most common primer pairs. The pipeline checks that your reads are long enough to merge for the region before it runs. Other primer pairs can be entered as custom primers.
| Region | Forward primer | Reverse primer | Insert length | Reads needed to merge |
|---|---|---|---|---|
| V3-V4 | 341FCCTACGGGNGGCWGCAG | 805RGACTACHVGGGTATCTAATCC | 427 bp | R1 + R2 ≥ 447 bp |
| V4 | 515F (Parada)GTGYCAGCMGCCGCGGTAA | 806R (Apprill)GGACTACNVGGGTWTCTAAT | 253 bp | R1 + R2 ≥ 273 bp |
| V1-V2 | 27FAGAGTTTGATCMTGGCTCAG | 338RGCTGCCTCCCGTAGGAGT | 273 bp | R1 + R2 ≥ 293 bp |
| V1-V3 | 27FAGAGTTTGATCMTGGCTCAG | 534RATTACCGCGGCTGCTGGCAC | 520 bp | R1 + R2 ≥ 540 bp |
| ITS1 | ITS1FCTTGGTCATTTAGAGGAAGTAA | ITS2GCTGCGTTCTTCATCGATGC | Variable | No fixed truncation |
| ITS2 | ITS3GCATCGATGAAGAACGCAGC | ITS4TCCTCCGCTTATTGATATGC | Variable | No fixed truncation |
Built for Canadian microbiome research
Data stays in Canada
Sequencing data is processed and stored on servers in Canada. Useful for Canadian universities, hospitals and labs with residency requirements.
Established, cited tools
Cutadapt, DADA2, SILVA v138.2, UNITE v9.0, PICRUSt2 and ANCOM-BC2: the same tools reviewers expect, with versions recorded in every report.
No coding, no cluster
No QIIME 2 install, R scripts or HPC queue. The pipeline checks primers, read orientation and merge length before it runs.
Publication-ready output
Interactive report, PDF, R-rendered figures, ASV and taxonomy tables, and a methods paragraph you can adapt.
16S and ITS analysis pricing in CAD
Pay per sample, with no subscription. Your first 3 analyses are free.
Amplicon Basic
- Primer trimming (Cutadapt)
- DADA2 denoising and ASV table
- Taxonomy against SILVA v138.2 (16S) or UNITE v9.0 (ITS)
- Phylum, genus and species composition
- AI-assisted interpretation of multi-sample studies
- PDF and interactive web report
- Paired-end and single-end reads
Amplicon Complete
- Everything in Amplicon Basic
- Species-level assignment where the region resolves it
- Phylogenetic tree (MAFFT + FastTree)
- Alpha diversity: Shannon, Simpson, Chao1, Faith's PD
- Rarefaction curves
- Functional prediction (PICRUSt2)
- Multi-sample projects: beta diversity, PERMANOVA, ANCOM-BC2
- Research data package (ZIP)
Bacterial isolate whole-genome sequencing (WGS)
Sequenced a pure bacterial isolate? The WGS pipeline identifies the species, assembles and annotates the genome, assigns an MLST type and detects antimicrobial resistance genes. Prices start at $15 CAD per sample.
- Quality control with fastp
- Species identification with Kraken2 and Bracken
- De novo assembly with SPAdes, quality with QUAST
- Annotation with Bakta and MLST typing
- AMR, stress and virulence genes with AMRFinderPlus
Learn 16S data analysis
Practical, referenced explanations of the decisions behind a good microbiome analysis.
16S rRNA Sequencing Data Analysis: A Complete Guide
How 16S rRNA amplicon data is analyzed, from raw FASTQ to taxonomy and diversity: primer trimming, DADA2 ASVs, SILVA classification, diversity statistics and reporting.
V3-V4 vs V4 vs V1-V3: Choosing a 16S Region
Which 16S rRNA hypervariable region to sequence: V3-V4, V4, V1-V2 or V1-V3. Primers, read lengths needed to merge, taxonomic resolution and best use cases.
ASVs vs OTUs: Why DADA2 Replaced OTU Clustering
The difference between amplicon sequence variants (ASVs) and operational taxonomic units (OTUs), why DADA2 ASVs are now the standard, and when OTUs still appear.
How Much Does 16S Analysis Cost in Canada?
What 16S rRNA data analysis costs in Canada in 2026: per-sample platform pricing in CAD, what is included, and the real cost of doing it yourself.
16S analysis questions, answered
What is BioAnalysis.ca?
BioAnalysis.ca is a Canadian online platform that analyzes 16S rRNA and ITS amplicon sequencing data, and bacterial isolate genomes. You upload FASTQ files in a browser and receive an interactive report, PDF, publication-ready figures and data tables. No coding or computing cluster is needed.
What files do I need to upload?
Illumina FASTQ files from a 16S or ITS amplicon run, paired-end (R1 and R2) or single-end, as .fastq, .fq, .fastq.gz or .fq.gz. Choose your primer preset or enter custom primers. For multi-sample statistics, add a sample metadata CSV or TSV; a template is provided.
Where is my sequencing data stored?
Sequencing data is processed and stored on servers in Canada. The AI-written interpretation in our reports is generated by Google's Gemini API from summary results (taxonomic composition, diversity, quality metrics and study statistics); sequencing reads are never sent. Uploaded FASTQ files are deleted 30 days after the analysis finishes, and you can permanently delete any analysis from your dashboard.
How much does 16S analysis cost?
Amplicon Basic costs $25 CAD per sample and Amplicon Complete costs $45 CAD per sample. There is no subscription, and the first 3 analyses on a new account are free with no credit card.
How long does a 16S analysis take?
About 30 minutes for Amplicon Basic and about an hour for Amplicon Complete, counted from the end of the upload. Progress for each pipeline step is shown live on your dashboard.
Do you sequence samples?
No. BioAnalysis.ca analyzes FASTQ files you already have. Samples are sequenced by a core facility or sequencing provider, which returns the FASTQ files that you upload here.
Which 16S regions and primers are supported?
Presets cover 16S V3-V4 (341F/805R), V4 (515F/806R), V1-V2 (27F/338R) and V1-V3 (27F/534R), and fungal ITS1 (ITS1F/ITS2) and ITS2 (ITS3/ITS4). Any other primer pair can be entered as custom primers.
Can I use the results in a publication?
Yes. Reports include publication-ready figures, the ASV and taxonomy tables, and the exact tool versions used. The How to cite page has a methods paragraph you can adapt. Results are for research use only, not clinical diagnosis.
Analyze your 16S or ITS data today
Your first 3 analyses are free, with no credit card. Upload FASTQ files and get a publication-ready report, processed and stored in Canada.